Sat, 12/30/2017 - 01:53
#2
random stuff for players
To see hydrogen bonds, turn on show bonds (non-protein) in view menu.
In lua, when using structure.GetAminoAcid(n) on an RNA molecule, foldit returns a 2-letter abbreviation for base n ("ra", "rc", "rg", or "ru").
Wikipedia has a page on secondary structure of RNA, with a few pictures of shapes that RNA can make:
https://en.wikipedia.org/wiki/Nucleic_acid_secondary_structure
More pics of shapes RNA can make - scroll down to the "secondary structure" section: http://www.sivabio.50webs.com/nucleicacidstructure.htm
Sat, 12/30/2017 - 19:43
#3
Need more tools
We really need a way to straighten out the backbone when it gets twisted (wiggle twists it a LOT when we use bands to move things around). No tweak, no remix, no rebuild, no cutting - it's very hard to recover from twisting!
The sequence of nucleotides (sidechains) for this puzzle is:
GGCAGAUCUGAGCCUGGGAGCUCUCUGCC