puzzle picture
1463: Classroom Puzzle: HIV RNA
Status: Closed

Groups

RankGroupScorePoints
1Go Science8,310100
2Beta Folders8,30873
3Anthropic Dreams8,29652
4Gargleblasters8,27936
5Another Hour Another Point8,27824
6Hun-Magyar Csapat8,26616
7Contenders8,25410
8L'Alliance Francophone8,2516
9Marvin's bunch8,2464
10Void Crushers8,2072
11GENE 4338,1361
12Russian team8,1151
13freefolder8,1041
14HBiochemSHS7,9971
15E?????! Heureka!7,9571
16stg pool7,9511
17DSN @ Home7,8231


Need this puzzle? Log in to download.  

Comments

Susume's picture
User offline. Last seen 5 hours 52 min ago. Offline
Joined: 10/02/2011
nucleotide sequence

The sequence of nucleotides (sidechains) for this puzzle is:
GGCAGAUCUGAGCCUGGGAGCUCUCUGCC

Susume's picture
User offline. Last seen 5 hours 52 min ago. Offline
Joined: 10/02/2011
random stuff for players

To see hydrogen bonds, turn on show bonds (non-protein) in view menu.

In lua, when using structure.GetAminoAcid(n) on an RNA molecule, foldit returns a 2-letter abbreviation for base n ("ra", "rc", "rg", or "ru").

Wikipedia has a page on secondary structure of RNA, with a few pictures of shapes that RNA can make:
https://en.wikipedia.org/wiki/Nucleic_acid_secondary_structure

More pics of shapes RNA can make - scroll down to the "secondary structure" section: http://www.sivabio.50webs.com/nucleicacidstructure.htm

Susume's picture
User offline. Last seen 5 hours 52 min ago. Offline
Joined: 10/02/2011
Need more tools

We really need a way to straighten out the backbone when it gets twisted (wiggle twists it a LOT when we use bands to move things around). No tweak, no remix, no rebuild, no cutting - it's very hard to recover from twisting!

Get Started: Download
  Windows    OSX    Linux  
Windows
(Vista/7/8)
OSX
(10.7 or later)
Linux
(64-bit)

Are you new to Foldit? Click here.

Are you a student? Click here.

Are you an educator? Click here.
Search
Only search fold.it
Recommend Foldit
User login
Soloists
Evolvers
Groups
Topics
Top New Users
Sitemap

Developed by: UW Center for Game Science, UW Institute for Protein Design, Northeastern University, Vanderbilt University Meiler Lab, UC Davis
Supported by: DARPA, NSF, NIH, HHMI, Microsoft, Adobe, RosettaCommons