puzzle picture
1463: Classroom Puzzle: HIV RNA
Status: Closed

Summary

Name: 1463: Classroom Puzzle: HIV RNA
Status: Closed
Created: 12/26/2017
Points: 100
Expired: 01/03/2018 - 18:00
Difficulty: Intermediate
Description: In this Classroom puzzle, students will learn about RNA structure and dynamics, as well as the ongoing debate between conformational capture and induced fit models of biomolecular binding. The RNA molecule of choice here, HIV TAR, is provided in one of its many possible folded conformations. However, we know the RNA is flexible, and it is still unclear what fold is most favorable for this molecule. See if you can find other stable folds for this RNA molecule! University of Denver students will be asked to read two articles alongside this Foldit puzzle. The first is a 2007 article by Zhang et al., which demonstrates an innovative experimental technique for probing the structure and dynamics of this RNA molecule. The second article is a 2009 report by Bardaro et al., in which the authors use more traditional techniques to examine how the structure of this RNA might respond to the presence of binding partners.
Categories: Pilot

Top Groups

RankGroupScorePoints
1Go Science8,310100
2Beta Folders8,30873
3Anthropic Dreams8,29652
4Gargleblasters8,27936
5Another Hour Another Point8,27824

Top Evolvers

Top Soloists



Need this puzzle? Log in to download.  

Comments

Susume's picture
User is online Online
Joined: 10/02/2011
nucleotide sequence

The sequence of nucleotides (sidechains) for this puzzle is:
GGCAGAUCUGAGCCUGGGAGCUCUCUGCC

Susume's picture
User is online Online
Joined: 10/02/2011
random stuff for players

To see hydrogen bonds, turn on show bonds (non-protein) in view menu.

In lua, when using structure.GetAminoAcid(n) on an RNA molecule, foldit returns a 2-letter abbreviation for base n ("ra", "rc", "rg", or "ru").

Wikipedia has a page on secondary structure of RNA, with a few pictures of shapes that RNA can make:
https://en.wikipedia.org/wiki/Nucleic_acid_secondary_structure

More pics of shapes RNA can make - scroll down to the "secondary structure" section: http://www.sivabio.50webs.com/nucleicacidstructure.htm

Susume's picture
User is online Online
Joined: 10/02/2011
Need more tools

We really need a way to straighten out the backbone when it gets twisted (wiggle twists it a LOT when we use bands to move things around). No tweak, no remix, no rebuild, no cutting - it's very hard to recover from twisting!

Get Started: Download
  Windows    OSX    Linux  
Windows
(7/8/10)
OSX
(10.7 or later)
Linux
(64-bit)

Are you new to Foldit? Click here.

Are you a student? Click here.

Are you an educator? Click here.
Search
Only search fold.it
Recommend Foldit
User login
Soloists
Evolvers
Groups
Topics
Top New Users
Sitemap

Developed by: UW Center for Game Science, UW Institute for Protein Design, Northeastern University, Vanderbilt University Meiler Lab, UC Davis
Supported by: DARPA, NSF, NIH, HHMI, Microsoft, Adobe, RosettaCommons