puzzle picture
1434: Classroom Puzzle: Phosphates in Biology
Status: Closed

Summary

Name: 1434: Classroom Puzzle: Phosphates in Biology
Status: Closed
Created: 09/27/2017
Points: 0
Expired: 10/04/2017 - 23:00
Difficulty: Intermediate
Description: Note: Due to player feedback and an excessive number of bugs, this puzzle was closed early and is worth zero points. Welcome to the first of the U. of Denver educational puzzles! In this puzzle, students will be asked to fold an RNA structure to help learn about the distinct chemical and structural properties of phosphorous in nucleic acids. Phosphates are essential to the structure of the RNA backbone; after enabling "Show advanced GUI" in General Options, try adjusting the View options to Stick mode with CPK colors to see the chemical structure of the RNA backbone. The RNA used for this puzzle is a section of Xist RNA, which is very important in gene transcription and cancer, but whose tertiary structure is still unknown. See if you can find a high-scoring structure for this RNA!

U. of Denver students will be asked to read two articles alongside this Foldit puzzle. The first is a landmark 1987 paper by Frank Westheimer discussing the unique role of biological phosphates; the second is a controversial 2010 paper by Wolfe-Simon et al. suggesting arsenic as a viable substitute for phosphorus.
Categories: Experimental

Top Groups

RankGroupScorePoints
1Go Science8,3580
2Anthropic Dreams8,3350
3Beta Folders8,3330
4Gargleblasters8,3040
5Contenders8,2030

Top Evolvers

Top Soloists



Need this puzzle? Log in to download.  

Comments

bkoep's picture
User offline. Last seen 2 days 2 hours ago. Offline
Joined: 11/15/2012
Groups: None
Additional reading

Typically, when the results of a scientific experiment challenge established theory, other scientists will try to replicate those results or design experiments to test alternate hypotheses.

The controversial arsenate paper has spawned some great follow-up research in this vein, such as the following two reports, which suggest alternate explanations for the results of Wolfe-Simon et al.:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3845625/

https://www.ncbi.nlm.nih.gov/pubmed/22798070/

SaraL's picture
User offline. Last seen 4 hours 47 min ago. Offline
Joined: 09/20/2011
Groups: Gargleblasters
Caution with Recipes

as this is not a standard protein, please exercise caution when using recipes. You may either break the puzzle or cause the program to crash.

SaraL's picture
User offline. Last seen 4 hours 47 min ago. Offline
Joined: 09/20/2011
Groups: Gargleblasters
Basic Tools

Do not use:

-Idealize
-Ideal SS
-Remix

This includes any recipe that does the same. It will cause the program to crash.

Joined: 11/03/2011
cuts don"t close,bands don't stick

it is impossible to close the cuts by wiggles
and it is close t-o impossible to stick bands to the atoms of sidechains

SaraL's picture
User offline. Last seen 4 hours 47 min ago. Offline
Joined: 09/20/2011
Groups: Gargleblasters
hmm

Finding GAB and BandFuze worthwhile.

Susume's picture
User offline. Last seen 38 min 16 sec ago. Offline
Joined: 10/02/2011
"Discovery" of what can be done

The user interface should help the player discover what actions are available. Leaving enabled actions that are not relevant (and crash the program) is poor UI practice (and drives players nuts).

Keeping hidden actions that actually work is also a mistake: in selection interface, whether you select something or not, the Shake button does not appear. However, the "S" hotkey (which many players don't know about) does make shake run, and it is good for points. If I can shake, show me the shake tool.

Btw Shake runs on all segments (whatever they are called in RNA), rather than only on selected ones; idk if that is on purpose or not.

Susume's picture
User offline. Last seen 38 min 16 sec ago. Offline
Joined: 10/02/2011
random stuff for players

To see hydrogen bonds, turn on show bonds (non-protein) in view menu.

The sequence of this piece of RNA is GGUUUUGUGAGUUAUUGCACUACC.

In lua, when using structure.GetAminoAcid(n) on an RNA molecule, foldit returns a 2-letter abbreviation for base n ("ra", "rc", "rg", or "ru").

Wikipedia has a page on secondary structure of RNA, with a few pictures of shapes that RNA can make:
https://en.wikipedia.org/wiki/Nucleic_acid_secondary_structure

More pics of shapes RNA can make - scroll down to the "secondary structure" section: http://www.sivabio.50webs.com/nucleicacidstructure.htm

alwen's picture
User offline. Last seen 1 hour 52 min ago. Offline
Joined: 10/03/2011
The tweak tool also crashes

The tweak tool also crashes this puzzle.

alwen's picture
User offline. Last seen 1 hour 52 min ago. Offline
Joined: 10/03/2011
But it's REALLY interesting

But it's REALLY interesting to have something new to play with!

I'm using CPK and Sphere view and trying to stick red areas to blue ones.

Susume's picture
User offline. Last seen 38 min 16 sec ago. Offline
Joined: 10/02/2011
Left/Right arrows not as expected

In proteins, you can select one segment and use left/right arrows to step through the sidechain positions. In the RNA, the left/right arrows seem to step through positions of the lone oxygen that hangs off the pentagon, rather than the positions of the large sidechain. Moving the large sidechain would be more useful.

NinjaGreg's picture
User offline. Last seen 2 hours 53 min ago. Offline
Joined: 05/21/2010
Groups: Go Science
Doesn't loop back on itself

Looking at a comparison of the sequence with the same sequence in reverse, we see:

GGUUUUGUGAGUUAUUGCACUACC
CCAUCACGUUAUUGAGUGUUUUGG

By sliding the second row along the first, we can see what matchups might occur. The four U's right after the initial GG do not have a matching sequence of four As, and there is not another GG sequence for the CC at the end to match up with.

alcor29's picture
User offline. Last seen 22 hours 51 min ago. Offline
Joined: 11/16/2012
colors of pairs suggestion

When dealing with RNA could we have GC one color and AU another color; or have each one have its own color. Either way, it would save some time and effort. Thanks.

frood66's picture
User offline. Last seen 2 hours 59 min ago. Offline
Joined: 09/20/2011
Groups: Marvin's bunch
re tool issues

It seems obvious that giving the option of a tool like remix (crashes client) - or the option to cut when a cut cannot be readily closed just causes frustration. Why are such basic bugs still in this puzzle?

No doubt all players have the same prob - but I do not think that is an excuse to be proud of.

Moving into the realms of RNA is interesting on some levels - but many here will have played another game based on this.....please can we do better than that game does?

NinjaGreg's picture
User offline. Last seen 2 hours 53 min ago. Offline
Joined: 05/21/2010
Groups: Go Science
my comments about the UI

1. Banding
A. Creating a band where you want it is difficult. Trying to attach to the end of the raised part of a pentagon (the part perpendicular to the pentagon itself), you have to have to the arrow head about halfway down before it snaps to the end. Go too far down, it snaps to the pentagon attachment point. Very hard to predict, and the "snap" areas appear to be very small -- had to carefully drag down the post until it snapped, going very slowly so I didn't miss it.
B. The bands don't work like in the regular puzzle due to the angular nature of the connections. If you want a tryptophan to move just a little closer to another of the residues, any pulling results in either no movement, or movement to one side of the other.
C. The default setting for the band tool is WAY too strong for this puzzle, it tends to whip the molecules around, rather than moving them gently. A way to say "make all my bands default to X strong" would be cool (also for the regular game!), allowing you to set that to say 0.25, then have all bands from then on start out at only 0.25.

2. Object of the puzzle.
A. I tried a reset, followed by a shake and a wiggle, and got up to where any further progress was measured in a very small number of points. IT doesn't reward you very efficiently for trying to find out how to get points. Having to glance up at the score between each move really gets in the way of the flow of the game, perhaps having a number appear after the move would help (the "+1" that appears, then goes away.)
B. Was the object to try to line up the aromatics of the residues in a spiral? Was it to try to match up the backbone somehow? Never did figure that out, and the lack of score movement noted above didn't help any.

3. Hydrogen bonds
A. Seemed like they had some difficulty forming, and even when they did it didn't change the score much. If that's the main way to gain points, the increment should be bigger.
B. Possibly related to A, the bonds didn't seem very "sticky" when they formed, appearing and disappearing without much effort on my part. Wiggle didn't seem to care about them, as it would just as happily break them as make them.

4. Colors
A. Agree with the note above about coloring AU versus GC. Unless the objective was just to line them up in a spiral, in which case it doesn't matter.
B. Having the color of one of the residues be very similar to the band color made it somewhat confusing.

Get Started: Download
  Windows    OSX    Linux  
Windows
(Vista/7/8)
OSX
(10.7 or later)
Linux
(64-bit)

Are you new to Foldit? Click here.

Are you a student? Click here.

Are you an educator? Click here.
Search
Only search fold.it
Recommend Foldit
User login
Soloists
Evolvers
Groups
Topics
Top New Users
Sitemap

Developed by: UW Center for Game Science, UW Institute for Protein Design, Northeastern University, Vanderbilt University Meiler Lab, UC Davis
Supported by: DARPA, NSF, NIH, HHMI, Microsoft, Adobe, RosettaCommons